Python : return True if ... else False statement (Boolean Value)

Question

Transitions between A <-> G and C <-> T
Transversions between A <-> C and G <-> T

Assignment:

Write a function transition that takes two nucleotides. The function must return a Boolean value that indicates whether or not replacing the first nucleotide by the second nucleotide leads to a transition.

Problem: I don't think the function recognizes the statement behind the or. The code doesn't work in some cases for example: transition('A', 'G') is True and with my code he gives False

Write a function ratio that takes two DNA sequences s1 and s2
The function may assume that both sequences have the same length (the function does not need to check this explicitly). The function must return the transition/transversion ratio R(s 1 ,s 2 )∈R of the two given sequences as a floating point number. In case there are no transversions between the two sequences, R(s 1 ,s 2 )=0 by definition.

Problem: the code is not working

def transition(letter1, letter2):        
    """
    >>> transition('G', 'A')
    True
    >>> transition('t', 'g')
    False
    >>> transition('C', 'c')
    False
    """    
    return True if letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt' else False


def transversion(letter1, letter2):
    """
    >>> transversion('G', 'A')
    False
    >>> transversion('t', 'g')
    True
    >>> transversion('C', 'c')
    False
    """
    return True if letter1.lower() == 'ct' and letter2.lower() == 'ag' or  letter1.lower() == 'ag' and letter2.lower() == 'ct' else False


def ratio(seq1, seq2):
    """
    >>> ratio('ATTAGCATTATCATC', 'AAATAGGATATATGG')
    0.2222222222222222
    >>> seq1 = 'GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT'
    >>> seq2 = 'ttatctgacaaagaaagccgtcaacggctggataatttcgcgatcgtgctggttactggcggtacgagtgttcctttgggt'
    >>> ratio(seq1, seq2)   
    1.2142857142857142
    """
    count = 0
    tel = 0

    for i in range(len(seq1)):
        if transition(seq1[i], seq2[i]):
            count += 1

    for i in range(len(seq1)):
        if transversion(seq1[i], seq2[i]):
            tel += 1

    if tel != 0:
        return float(count / tel)
    else:
        return 0 

if __name__ == '__main__':
    import doctest
    doctest.testmod()

You already have a boolean result. Just return that rather than using True if expression else False. expression itself is already producing True or False in most cases. If not, use bool(expression), but only if you must have a boolean. if doesn't need a boolean, for example. — Martijn Pieters
– Martijn Pieters, Commented Oct 30, 2017 at 19:21
'g' != 'gt'. == is "is this thing equal to this other thing", not "is this thing equal to part of this other thing". — user2357112
– user2357112, Commented Oct 30, 2017 at 19:28
letter1.lower() == "gt" should be letter1.lower() in "gt" — Barmar
– Barmar, Commented Oct 30, 2017 at 19:51
@Lien please upvote and accept answer if it solved your problem. Thanks ;-) — Indent
– Indent, Commented Nov 8, 2017 at 10:12

Indent · Accepted Answer · 2017-10-30 19:22:09Z

2

Change the lines like this

return True if letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt' else False

by :

return (letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt')

answered Oct 30, 2017 at 19:22

Indent

4,9671 gold badge22 silver badges39 bronze badges

Sign up to request clarification or add additional context in comments.

2 Comments

Lien Over a year ago

Ok but it gives still wrong results in some cases. I don't understand why.

Lien Over a year ago

He never returns True value only False

Indent · Accepted Answer · 2017-10-31 08:19:22Z

I think transition or transversion of same nucleobase must return False
( ie transition('A','A')==False )

You can simplify using simple naming predicat : https://repl.it/N4TC/4

def transition(nucleobase1, nucleobase2):        
   """ True if both are different and are purine
   """
   return (not isEqual(nucleobase1, nucleobase2) and
           isPurine(nucleobase1) and 
           isPurine(nucleobase2))

def transversion(nucleobase1, nucleobase2):        
   """ True if both are different and not transition
   """
   return (not isEqual(nucleobase1, nucleobase2) and
           not transition(nucleobase1, nucleobase2))

Other predicat :

### nucleobase Predicat    

def isAdenine(nucleobase):
    """ True if adenine (A)
    """
    return nucleobase.lower()=='a'

def isCytosine(nucleobase):
    """ True if cytosine (C)
    """
    return nucleobase.lower()=='c'

def isGuanine(nucleobase):
    """ True if guanine (G)
    """
    return nucleobase.lower()=='g'

def isThymine(nucleobase):
    """ True if thymine (T)    
    """
    return nucleobase.lower()=='t'

def isPurine(nucleobase):
    """ True if adenine (A) or guanine (G)
    """
    return isAdenine(nucleobase) or isGuanine(nucleobase)

def isPyrimidine(nucleobase):
    """ True if cytosine (C) or thymine (T)
    """
    return isCytosine(nucleobase) or isThymine(nucleobase)

def isEqual(nucleobase1, nucleobase2):
    """ Equal ignore case
    """
    return nucleobase1.lower()==nucleobase2.lower()

Anton vBR · Accepted Answer · 2017-10-31 08:29:42Z

1

As a general rule of thumb you can if you have multiple conditions assign them to variables first. Might not be the answer you were looking for but possibly can help you write easier-to-read code.

Like this:

letter1 = "GT"
letter2 = "AC"

def transition(letter1, letter2):

    cond1 = (letter1.lower() == 'gt')
    cond2 = (letter2.lower() == 'ac')
    cond3 = (letter1.lower() == 'ac')
    cond4 = (letter2.lower() == 'gt')

    if (cond1 and cond2) or (cond3 and cond4):
        return True
    else:
        return False

transition(letter1,letter2)

answered Oct 31, 2017 at 8:29

Anton vBR

19k6 gold badges47 silver badges47 bronze badges

Comments

Mrioddo · Accepted Answer · 2017-10-30 19:51:57Z

0

Try this:

def transition(letter1, letter2):        
   """
   >>> transition('G', 'A')
   True
   >>> transition('t', 'g')
   False
   >>> transition('C', 'c')
   False
   """
   if letter1.lower() == letter2.lower():
       return False

   return (letter1.lower() in 'ag' and letter2.lower() in 'ag') or (letter1.lower() in 'ct' and letter2.lower() in 'ct')

and

def transversion(letter1, letter2):        
   """
   >>> transversion('G', 'A')
   False
   >>> transition('t', 'g')
   True
   >>> transition('C', 'c')
   False
   """
   if letter1.lower() == letter2.lower():
       return False

   return (letter1.lower() in 'ac' and letter2.lower() in 'ac') or (letter1.lower() in 'gt' and letter2.lower() in 'gt')

It seems with letter1.lower() == 'gt' you are trying to check if the letter is either g or t. You do that with in instead of ==.

answered Oct 30, 2017 at 19:51

Mrioddo

257 bronze badges

1 Comment

Mrioddo Over a year ago

@Lien You're welcome! If it solved your problem, please accept it as an answer! From the Help Center: "Please do not add a comment on your question or on an answer to say 'Thank you'. [...] If you want to say 'thank you,' vote on or accept that person's answer [...]."

Collectives™ on Stack Overflow

Python : return True if ... else False statement (Boolean Value)

4 Answers 4

2 Comments

Comments

Comments

1 Comment

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

4 Answers 4

2 Comments

Comments

Comments

1 Comment

Your Answer

Sign up or log in

Post as a guest

Related