Convert file to binary code in Python

Question

I am looking to convert a file to binary for a project, preferably using Python as I am most comfortable with it, though if walked-through, I could probably use another language.

Basically, I need this for a project I am working on where we want to store data using a DNA strand and thus need to store files in binary ('A's and 'T's = 0, 'G's and 'C's = 1)

Any idea how I could proceed? I did find that use could encode in base64, then decode it, but it seems a bit inefficient, and the code that I have doesn't seem to work...

import base64
import tkinter as tk
from tkinter import filedialog

root = tk.Tk()
root.withdraw()
file_path = filedialog.askopenfilename()
print(file_path)
with open(file_path) as f:
    encoded = base64.b64encode(f.readlines())
    print(encoded)

Also, I already have a program to do that simply with text. Any tips on how to improve it would also be appreciated!

import binascii
t = bytearray(str(input("Texte?")), 'utf8')
h = binascii.hexlify(t)
b = bin(int(h, 16)).replace('b','') 
#removing the b that appears in the end for some reason
g = b.replace('1','G').replace('0','A')
print(g)

For example, if I input test: ok so for the text to DNA: I input 'test' and expect the DNA sequence that comes from the binary the binary being: 01110100011001010111001101110100 (Also I asked to print every conversion in the example so that it is more comprehensible)

>>>Texte?test #Asks the text
>>>b'74657374' #converts to hex
>>>01110100011001010111001101110100 #converts to binary
>>>AGGGAGAAAGGAAGAGAGGGAAGGAGGGAGAA #converts 0 to A and 1 to G

If you're going from four characters to two, aren't you inevitably losing information? How can you get it back again? — jonrsharpe
– jonrsharpe, Commented Oct 26, 2015 at 16:26
Do you mean because we are using A and T for 0 and G and C for 1? — Oscar B
– Oscar B, Commented Oct 26, 2015 at 17:07
Well since the information at the beginning is in binary I don't see how that would make us lose information (I'm maybe not explaining it well...) — Oscar B
– Oscar B, Commented Oct 26, 2015 at 17:08
I'd say definitely not. Could you give a minimal reproducible example, including sample inputs and expected and actual outputs? — jonrsharpe
– jonrsharpe, Commented Oct 26, 2015 at 17:10

Oscar B · Accepted Answer · 2015-10-26 22:38:31Z

2

So, thanks to @jonrshape and Sergey Vturin, I finally was able to achieve what I wanted! My program asks for a file, turns it into binary, which then gives me its equivalent in "DNA code" using pairs of binary numbers (00 = A, 01 = T, 10 = G, 11 = C)

import binascii
from tkinter import filedialog

file_path = filedialog.askopenfilename()

x = ""
with open(file_path, 'rb') as f:
    for chunk in iter(lambda: f.read(32), b''):
        x += str(binascii.hexlify(chunk)).replace("b","").replace("'","")
b = bin(int(x, 16)).replace('b','')
g = [b[i:i+2] for i in range(0, len(b), 2)]
dna = ""
for i in g:
    if i == "00":
        dna += "A"
    elif i == "01":
        dna += "T"
    elif i == "10":
        dna += "G"
    elif i == "11":
        dna += "C"
print(x) #hexdump
print(b) #converted to binary
print(dna) #converted to "DNA"

answered Oct 26, 2015 at 22:38

Oscar B

311 gold badge1 silver badge7 bronze badges

Sign up to request clarification or add additional context in comments.

Comments

user3666197 · Accepted Answer · 2015-10-26 18:43:33Z

0

Of course, it is inefficient!
base64 is designed to store binary in a text. It makes a bigger size block after conversion.

btw: what efficiency do you want? compactness?

if so: second sample is much nearer to what you want

btw: in your task you loose information! Are you aware of this?

Here is a sample how to store and restore.

It stores data in an easy to understand Hex-In-Text format -- just for the sake of a demo. If you want compactness - you can easily modify the code so as to store in binary file or if you want 00011001 view - modification will be easy too.

import math
#"make a long test string"
import numpy as np
s=''.join((str(x) for x in np.random.randint(4,size=33)))\
    .replace('0','A').replace('1','T').replace('2','G').replace('3','C')

def store_(s):
    size=len(s) #size will changed to fit 8*integer so remember true value of it and store with data
    s2=s.replace('A','0').replace('T','0').replace('G','1').replace('C','1')\
        .ljust( int(math.ceil(size/8.)*8),'0') #add '0' to 8xInt to the right
    a=(hex( eval('0b'+s2[i*8:i*8+8]) )[2:].rjust(2,'0') for i in xrange(len(s2)/8))
    return ''.join(a),size

yourDataAsHexInText,sizeToStore=store_(s)
print yourDataAsHexInText,sizeToStore


def restore_(s,size=None):
    if size==None: size=len(s)/2
    a=( bin(eval('0x'+s[i*2:i*2+2]))[2:].rjust(8,'0') for i in xrange(len(s)/2))
    #you loose information, remember?, so it`s only A or G
    return (''.join(a).replace('1','G').replace('0','A') )[:size]

restore_(yourDataAsHexInText,sizeToStore)


print "so check it"
print s ,"(input)"
print store_(s)
print s.replace('C','G').replace('T','A') ,"to compare with information loss"
print restore_(*store_(s)),"restored"
print s.replace('C','G').replace('T','A') == restore_(*store_(s))

result in my test:

63c9308a00 33
so check it
AGCAATGCCGATGTTCATCGTATACTTTGACTA (input)
('63c9308a00', 33)
AGGAAAGGGGAAGAAGAAGGAAAAGAAAGAGAA to compare with information loss
AGGAAAGGGGAAGAAGAAGGAAAAGAAAGAGAA restored
True

edited Oct 26, 2015 at 18:43

user3666197

1

answered Oct 26, 2015 at 18:09

Sergey Vturin

513 bronze badges

7 Comments

Oscar B Over a year ago

Thanks a lot for your answer! But I am a bit lost, could you please explain a bit more your code? Also what is the input supposed to be here? Because it seems that you are trying inputting only A, T, G and C

Sergey Vturin Over a year ago

maybe i not so good understand, but yes- this sample wait a string of "A, T, G and C" if you want to binary to dna as in your sample then you could use only modified restore_ (just modify to bin instead of hex) explain: store_ split input string to groups by 8, interpret each group as binary integer value and store in (in hex, but you can store in any format you want). restore_ interpret evert 2-symbol fragment as integer (here you can change to any format you want)- and convert it back.

Oscar B Over a year ago

Oh. So to be concise: I want to convert a file or a text to DNA. So like on the example I enter 'test' and it returns the 'equivalent' in DNA. That is what I want for files. So I would need to have the file turned into binary to be able to convert it into DNA

Sergey Vturin Over a year ago

it's meaningless in my point of view, but it's easy. if consider every char of input string as binary. // s="test" (''.join((bin(ord(x))[2:].rjust(8,'0') for x in s)).replace('1','G').replace('0','A') ) // you can use that isolated or like in a sample- it is modified second string of restore_

Sergey Vturin Over a year ago

stackoverflow.com/questions/1035340/…

|

Collectives™ on Stack Overflow

Convert file to binary code in Python

2 Answers 2

Comments

7 Comments

Your Answer

Linked

Hot Network Questions

Collectives™ on Stack Overflow

2 Answers 2

Comments

7 Comments

Your Answer

Sign up or log in

Post as a guest

Linked

Related